fastDNAml 1.0 Gary J. Olsen, Department of Microbiology University of Illinois, Urbana, IL gary@phylo.life.uiuc.edu Hideo Matsuda, Mathematics and Computer Science Argonne National Laboratory, Argonne, IL matsuda@mcs.anl.gov Ray Hagstrom, Physics Argonne National Laboratory, Argonne, IL hagstrom@mcs.anl.gov Ross Overbeek, Mathematics and Computer Science Argonne National Laboratory, Argonne, IL overbeek@mcs.anl.gov Citing fastDNAml If you publish work using fastDNAml, please cite the following publications: Olsen, G. J., Matsuda, H., Hagstrom, R., and Overbeek, R. 1994. fastDNAml: A tool for construction of phylogenetic trees of DNA sequences using maximum likelihood. Comput. Appl. Biosci. 10: 41-48. Felsenstein, J. 1981. Evolutionary trees from DNA sequences: A maximum likelihood approach. J. Mol. Evol. 17: 368-376. What is fastDNAml fastDNAml is a program derived from Joseph Felsenstein's version 3.3 DNAML (part of his PHYLIP package). Users should consult the documentation for DNAML before using this program. fastDNAml is an attempt to solve the same problem as DNAML, but to do so faster and using less memory, so that larger trees and/or more bootstrap replicates become tractable. Much of fastDNAml is merely a recoding of the PHYLIP 3.3 DNAML program from PASCAL to C. DNAML includes the following notice: version 3.3. (c) Copyright 1986, 1990 by the University of Washington and Joseph Felsenstein. Written by Joseph Felsenstein. Permission is granted to copy and use this program provided no fee is charged for it and provided that this copyright notice is not removed. Why is fastDNAml faster? Some recomputation of values has been eliminated (Joe Felsenstein has done much of this in version 3.4 DNAML). The optimization of branch lengths has been accelerated by changing from an EM method to Newton's method (Joe Felsenstein has done much of this in version 3.4 DNAML). The strategy for simultaneously optimizing all of the branches on the tree has been modified to spend less time getting an individual branch right before improving the other branches. Other new features in fastDNAml fastDNAml includes a checkpoint feature to regularly save its progress toward finding a large tree. If the program is interrupted, a minor change to the input file and adding the R (restart) option permits the work to be resumed from the last checkpoint. The new R {restart) option can also be used for more rapid addition of new sequences to a previously computed tree (when new sequences are added to the alignment, it is best if the relative alignment of the previous sequences is not altered). The G (global) option has been generalized to permit crossing any number of branches during tree rearrangements. In addition, it is possible to modify the extent of rearrangement explored during the sequential addition phase of tree building. The G U (global and user tree) option combination instructs the program to find the best of the user trees, and then look for rearrangements that are better still. The number of available rate categories has been raised from 9 to 35. The weighting mask accepts values from 0 through 35. The new B (bootstrap) option causes generation of a bootstrap sample, drawn from the input data. The program includes "P4" code for distributing the problem over multiple processors (either within one machine, or across multiple machines). Do DNAML and fastDNAml give the same answer? Generally yes, though there are some reservations: One or the other might find a better tree due to minor changes in the ways trees are searched. When sequence addition is replicated with different values of the jumble random number seed, they have about the same probability of finding the best tree, but any given seed might give different trees. The likelihoods and branch lengths sometimes differ very slightly due to different criteria for stopping the optimization process. An earlier version of fastDNAml had an error in generating tree rearrangements in the search for better trees. This did not affect the default (local) rearrangements, but could have caused the program to miss some global rearrangements. We think that it is now correct, but it is one of the most difficult program features to test. Little has been done to check the confidence limits on branch lengths. There seem to be some instances in which they disagree, and we think that fastDNAml is correct. However, do not take the "significantly greater than zero" too seriously. If you are concerned, you can supply a tree inferred by fastDNAml as a user tree to PHYLIP DNAML and let it (1) reoptimize branch lengths, (2) tell you the confidence limits and (3) tell you the tree likelihood. (It may be necessary to remove the quotation marks around the species names in the treefile.) Features in the works Test subtree exchanges (as well as moving a single subtree) in the search for better trees. More quickly evaluating whether a tree is a good candidate for best tree. Allowing the program to optimize any user-defined subset of branches when user lengths are supplied. Maintaining a list of the several best trees, not just the (single) best. Input and Options Basics The input to fastDNAml is similar to that used by DNAML (and the other PHYLIP programs). The user should consult the PHYLIP documentation for a basic description of the format. This version of fastDNAml expects to get its input from stdin (standard input) and writes its output to stdout (standard output). (There are compile time options to modify this, for those who care to get into such things.) On a UNIX system, it is a simple matter to redirect input from a file and output to a file: fastDNAml < infile > outfile On a VMS system it is only slightly more difficult. Immediately before running the program, one includes two commands that define the input and output files: $ Define/User Sys$Input infile $ Define/User Sys$Output outfile $ Run fastDNAml The default input data format is Interleaved (see I option). To help get data from a GenBank or similar format, the interleaved option can be switched off with the I option. Numbers in the sequence data (i.e., sequence position numbers) will be ignored, so they need not be stripped out. (Note that the program also writes a file called checkpoint.PID. See the R option below for more description.) 1 -- Print Data By default, fastDNAml 1.0 does not echo the sequence data to the output file. Option 1 reverses this. 3 -- Do Not Print Tree By default, fastDNAml 1.0 prints the final tree to the output file. Option 3 reverses this. 4 -- Write Tree to File By default, fastDNAml 1.0 does not write a machine readable (Newick format) copy of the final tree to an output file. Option 4 reverses this. The tree output file will be called treefile.PID (where PID is the process ID under which fastDNAml is running). B -- Bootstrap Generates a bootstrap sample of the input data. Requires auxiliary data line of the form: B random_number_seed Example: 5 114 B B 137 If the W option is used, only positions that have nonzero weights are used in computing the bootstrap sample. Warning: For a given random number seed, the sample will always be the same. PHYLIP DNAML does not include a bootstrap option. (Use the DNABOOT program.) C -- Categories Requires auxiliary data of the form: C number_of_categories list_of_category_rates The maximum number of categories is 35. This line is followed by a list of the rates for each site: Categories list_of_categories [per site, one or more lines] Category "numbers" are ordered: 1, 2, 3, ..., 9, A, B, ..., Y, Z. Category zero (undefined rate) is permitted at sites with a zero in a user-supplied weighting mask. Example: 5 114 C C 12 0.0625 0.125 0.25 0.5 1 2 4 8 16 32 64 128 Categories 5111136343678975AAA8949995566778888889AAAAAA9239898629AAAAA9 633792246624457364222574877188898132984963499AA9899975 PHYLIP DNAML is limited to categories 1 through 9. Also, in PHYLIP version 3.3, the categories data came after all the other auxiliary data, but before the user-supplied base frequencies and sequence data. If you make the C line your last auxiliary data line, the programs will behave the same. F -- Empirical Frequencies Instructs the program to use empirical base frequencies derived from the sequence data. Therefore the input file should not include a base frequencies line preceding the data. Example: 5 114 F G -- Global If the global option is specified, there may also be an [optional] auxiliary data line of form: G N1 or G N1 N2 N1 is the number of branches to cross in rearrangements of the completed tree. The value of N2 is the number of branches to cross in testing rearrangements during the sequential addition phase of tree inference. N1 = 1: local rearrangement (default without G option) 1 < N1 < numsp-3: regional rearrangements (crossing N1 branches) N1>= numsp-3: global rearrangements (default with G option) N2 <= N1 the default N2 is 1, local rearrangements. The G option can also be used to force branch swapping on user trees, that is, a combination of G and U options. If the auxiliary line is supplied, it cannot be the last line of auxiliary data. (It may be necessary to add the T option with an auxiliary data line of T 2.0 if no other auxiliary data are used.) Examples: Do local rearrangements after each addition, and global after last addition: 5 114 G Do local rearrangements after each addition, and regional (crossing 4 branches) after last addition: 5 114 G T G 4 T 2.0 Do no rearrangements after each addition, and local after last addition: 5 114 G T G 1 0 T 2.0 PHYLIP DNAML does not support the auxiliary data line or branch swapping on a user tree. I -- Not Interleaved By default, fastDNAml 1.0 expects data lines for the various sequences in an interleaved format (as did PHYLIP 3.3 DNAML). The I option reverses the expected format (to non-interleaved data, in which all the data lines for one sequence before the next sequence begins). This is particularly useful for editing a GenBank or equivalent format into a valid input file (note that numbers within the sequence data are ignored, so it is not necessary to remove them). If all the data for each sequence are on one line, then the interleaved and non-interleaved formats are degenerate. (This is the way David Swofford's PAUP program writes PHYLIP format output files.) The drawback is that many programs do not handle long lines of text. This includes the vi and EDT text editors, many electronic mail programs, and some versions of FTP for VAX/VMS systems. PHYLIP 3.3 DNAML expects interleaved data, and does not include an I option to alter this. PHYLIP 3.4 DNAML accepts an I option, but the default format is reversed. J -- Jumble Randomize the sequence addition order. Requires an auxiliary input line of the form: J random_number_seed Example: 5 114 J J 137 Note that fastDNAml explores a very small number of alternative tree topologies relative to a typical parsimony program. There is a very real chance that the search procedure will not find the tree topology with the highest likelihood. Altering the order of taxon addition and comparing the trees found is a fairly efficient method for testing convergence. Typically, it would be nice to find the same best tree at least twice (if not three times), as opposed to simply performing some fixed number of jumbles and hoping that at least one of them will be the optimum. L -- User Lengths Causes user trees to be read with branch lengths (and it is an error to omit any of them). Without the L option, branch lengths in user trees are not required, and are ignored if present. Example: 5 114 U L (The U is for user tree and the L for user lengths) O -- Outgroup Use the specified sequence number for the outgroup. Requires an auxiliary data line of the form: O outgroup_number Example: 5 114 O O 5 This option only affects the way the tree is drawn (and written to the treefile). Q -- Quickadd This option greatly decreases the time in initially placing a new sequence in the growing tree (but does not change the time required to subsequently test rearrangements). The overall time savings seems to be about 30%, based on a very limited number of test cases. Its downside, if any, is unknown. This will probably become default program behavior in the near future. If the analysis is run with a global option of "G 0 0", so that no rearrangements are permitted, the tree is build very approximately, but very quickly. This may be of greatest interest if the question is, "Where does this one new sequence fit into this known tree? The known tree is provided with the restart option, below. PHYLIP DNAML does not include anything comparable to the quickadd option. R -- Restart The R option causes the program to read a user-supplied tree with less than the full number of taxa as the starting point for sequential addition of the remaining taxa. Thus, the sequence data must be followed by a valid (Newick format) tree. (The phylip_tree/2, prolog fact format, is now also supported.) The restart option can also be used to increase the range of the search for alternative (better) trees. For example, you can take a tree produced with only "local" tree rearrangements, and increase the rearrangements to "regional" or "global" by combining the appropriate global option with the restart option. If the starting tree was written by fastDNAml, then the extent of rearrangements is saved with the tree, and will be used as the starting point for the additional search. If the tree was already globally optimized, then no additional searching will be performed. To support the R option, after each taxon is added to the growing tree, and after each round of rearrangements, the program appends a checkpoint tree to a file called checkpoint.PID, where PID is the process number of the running fastDNAml program. The last line of this file needs to be appended to the input file when the R option is used. (This should not be confused with the U (user tree) option, which expects a number followed by that number of trees. No additional taxa are added to user trees.) The UNIX utility tail can be used to remove the last tree from the checkpoint file, and the utility cat can be used to append it to the input. For example, the following script can be used to add a starting tree and the R option to a data file, and restart fastDNAml: #! /bin/sh if test $# -ne 1 then echo "Usage: restart checkpoint_file" exit fi read first_line # first line of data file echo "$first_line R" # add restart option cat - # rest of data file tail -1 $1 # append last tree in checkpoint file If this shell script is in the file called restart, then one might use the command: restart checkpoint.21312 < infile | fastDNAml > new_outfile ^script ^checkpoint tree ^data ^dnaml program ^output_file If this is too opaque, don't worry about it, or talk with your local unix wizard. In the mean time, this and other useful shell scripts are provided with the program. PHYLIP DNAML does not write checkpoint trees and does not have a restart option. T -- Transition/transversion ratio Use a user-specified ratio of transition to transversion type substitutions. Without the T option, a value of 2.0 is used. Requires an auxiliary data line of the form: T ratio Example: 5 114 T T 1.0 (Note that a T option with a value of 2.0 does nothing, but it can provide a last auxiliary data line following optional auxiliary data. See the examples for G and Y.) U -- User Tree(s) Read an input line with the number of user-specified trees, followed by the specified number of trees. These data immediately follow the sequence data. The trees must be in Newick format, and terminated with a semicolon. (The program also accepts a pseudo_newick format, which is a valid prolog fact.) The tree reader in this program is more powerful than that in PHYLIP 3.3. In particular, material enclosed in square brackets, [ like this ], is ignored as comments; taxa names can be wrapped in single quotation marks to support the inclusion of characters that would otherwise end the name (i.e., '(', ')', ':', ';', '[', ']', ',' and ' '); names of internal nodes are properly ignored; and exponential notation (such as 1.0E-6) for branch lengths is supported. W -- Weights Read user-specified column weighting information. This option requires auxiliary data of the form: Weights list_of_weight_values [per site, one or more lines] Example: 5 114 W Weights 111111111111001100000100011111100000000000000110000110000000 111101111111111111111111011100000111001011100000000011 It is necessary that the weight values not start before the 11'th character in the line, or some of them will be lost. Weights from 0 to 35 are indicated by the series: 0, 1, 2, 3, ..., 9, A, B, ..., Y, Z. PHYLIP DNAML does not support user weights with values other than 1 or 0. This limit has been removed in fastDNAml 1.0 to permit the use of user weights as a mechanism for representing a bootstrap sample (that is, only the auxiliary data lines change, not the body of the data file). Y -- Write Tree Output final tree to an output file called treefile.PID. By default the tree is in Newick format. If an auxiliary input line of the form Y 2 is also included, then the tree output file is written as a prolog fact: pseudo_newick([Comment], (Subtree1, Subtree2, Subtree3):Length). where each subtree is either (Subtree1,Subtree2):Length or Label:Length Because this auxiliary input line is optional, it cannot be the last auxiliary data line. Examples: 5 114 Y 5 114 Y T Y 2 T 2.0 PHYLIP DNAML does not append the PID (process ID) to the tree file name and does not support the prolog format output. Examples: Data file with empirical frequencies (generic analysis): 5 114 F Sequence1 ACACGGTGTCGTATCATGCTGCAGGATGCTAGACTGCGTCANATGTTCGTACTAACTGTG Sequence2 ACGCGGTGTCGTGTCATGCTACATTATGCTAGACTGCGTCGGATGCTCGTATTGACTGCG Sequence3 ACGCGGTGCCGTGTNATGCTGCATTATGCTCGACTGCGRCGGATGCTAGTATTGACTGCG Sequence4 ACGCGCTGCCGTGTCATCCTACACGATGCYAGACAGCGTCAGCTGCTAGTACTGGCTGAG Sequence5 ACGCGCTGTCGTGTCATACTGCAGGATGCTAGACTGCGTCAGCTGCTAGTACTGGCTGAG AGCTCGATGATCGGTGACGTAGACTCAGGGGCCATGCCGCGAGTTTGCGATGCG AGCACGGTGATCAATGACGTAGNCTCAGGRTCCACGCCGTGACTTTGTGATNCG AGCACGATGACCGATGACGTAGACTGAGGGTCCGTGCCGCGACTTTGTGATGCG ACCTCGGTGATTGATGACGTAGACTGCGGGTCCATGCCGCGATTTTGCGRTGCG ACCTCGATGCTCGATGACGTAGACTGCGGGTCCATGCCGTGATTTTGCGATGCG Data file with empirical frequencies and a random addition order: 5 114 F J J 137 Sequence1 ACACGGTGTCGTATCATGCTGCAGGATGCTAGACTGCGTCANATGTTCGTACTAACTGTG Sequence2 ACGCGGTGTCGTGTCATGCTACATTATGCTAGACTGCGTCGGATGCTCGTATTGACTGCG Sequence3 ACGCGGTGCCGTGTNATGCTGCATTATGCTCGACTGCGRCGGATGCTAGTATTGACTGCG Sequence4 ACGCGCTGCCGTGTCATCCTACACGATGCYAGACAGCGTCAGCTGCTAGTACTGGCTGAG Sequence5 ACGCGCTGTCGTGTCATACTGCAGGATGCTAGACTGCGTCAGCTGCTAGTACTGGCTGAG AGCTCGATGATCGGTGACGTAGACTCAGGGGCCATGCCGCGAGTTTGCGATGCG AGCACGGTGATCAATGACGTAGNCTCAGGRTCCACGCCGTGACTTTGTGATNCG AGCACGATGACCGATGACGTAGACTGAGGGTCCGTGCCGCGACTTTGTGATGCG ACCTCGGTGATTGATGACGTAGACTGCGGGTCCATGCCGCGATTTTGCGRTGCG ACCTCGATGCTCGATGACGTAGACTGCGGGTCCATGCCGTGATTTTGCGATGCG Data file with empirical frequencies and a bootstrap resampling: 5 114 F B B 137 Sequence1 ACACGGTGTCGTATCATGCTGCAGGATGCTAGACTGCGTCANATGTTCGTACTAACTGTG Sequence2 ACGCGGTGTCGTGTCATGCTACATTATGCTAGACTGCGTCGGATGCTCGTATTGACTGCG Sequence3 ACGCGGTGCCGTGTNATGCTGCATTATGCTCGACTGCGRCGGATGCTAGTATTGACTGCG Sequence4 ACGCGCTGCCGTGTCATCCTACACGATGCYAGACAGCGTCAGCTGCTAGTACTGGCTGAG Sequence5 ACGCGCTGTCGTGTCATACTGCAGGATGCTAGACTGCGTCAGCTGCTAGTACTGGCTGAG AGCTCGATGATCGGTGACGTAGACTCAGGGGCCATGCCGCGAGTTTGCGATGCG AGCACGGTGATCAATGACGTAGNCTCAGGRTCCACGCCGTGACTTTGTGATNCG AGCACGATGACCGATGACGTAGACTGAGGGTCCGTGCCGCGACTTTGTGATGCG ACCTCGGTGATTGATGACGTAGACTGCGGGTCCATGCCGCGATTTTGCGRTGCG ACCTCGATGCTCGATGACGTAGACTGCGGGTCCATGCCGTGATTTTGCGATGCG Data with weighting mask and rate categories: 5 114 F W C Weights 111111111111001100000100011111100000000000000110000110000000 111101111111111111111111011100000111001011100000000011 C 10 0.0625 0.125 0.25 0.5 1 2 4 8 16 32 Categories 5111136343678975AAA8949995566778888889AAAAAA9239898629AAAAA9 633792246624457364222574877188898132984963499AA9899975 Sequence1 ACACGGTGTCGTATCATGCTGCAGGATGCTAGACTGCGTCANATGTTCGTACTAACTGTG Sequence2 ACGCGGTGTCGTGTCATGCTACATTATGCTAGACTGCGTCGGATGCTCGTATTGACTGCG Sequence3 ACGCGGTGCCGTGTNATGCTGCATTATGCTCGACTGCGRCGGATGCTAGTATTGACTGCG Sequence4 ACGCGCTGCCGTGTCATCCTACACGATGCYAGACAGCGTCAGCTGCTAGTACTGGCTGAG Sequence5 ACGCGCTGTCGTGTCATACTGCAGGATGCTAGACTGCGTCAGCTGCTAGTACTGGCTGAG AGCTCGATGATCGGTGACGTAGACTCAGGGGCCATGCCGCGAGTTTGCGATGCG AGCACGGTGATCAATGACGTAGNCTCAGGRTCCACGCCGTGACTTTGTGATNCG AGCACGATGACCGATGACGTAGACTGAGGGTCCGTGCCGCGACTTTGTGATGCG ACCTCGGTGATTGATGACGTAGACTGCGGGTCCATGCCGCGATTTTGCGRTGCG ACCTCGATGCTCGATGACGTAGACTGCGGGTCCATGCCGTGATTTTGCGATGCG Data with three user-specified tree branching orders: 5 114 F U Sequence1 ACACGGTGTCGTATCATGCTGCAGGATGCTAGACTGCGTCANATGTTCGTACTAACTGTG Sequence2 ACGCGGTGTCGTGTCATGCTACATTATGCTAGACTGCGTCGGATGCTCGTATTGACTGCG Sequence3 ACGCGGTGCCGTGTNATGCTGCATTATGCTCGACTGCGRCGGATGCTAGTATTGACTGCG Sequence4 ACGCGCTGCCGTGTCATCCTACACGATGCYAGACAGCGTCAGCTGCTAGTACTGGCTGAG Sequence5 ACGCGCTGTCGTGTCATACTGCAGGATGCTAGACTGCGTCAGCTGCTAGTACTGGCTGAG AGCTCGATGATCGGTGACGTAGACTCAGGGGCCATGCCGCGAGTTTGCGATGCG AGCACGGTGATCAATGACGTAGNCTCAGGRTCCACGCCGTGACTTTGTGATNCG AGCACGATGACCGATGACGTAGACTGAGGGTCCGTGCCGCGACTTTGTGATGCG ACCTCGGTGATTGATGACGTAGACTGCGGGTCCATGCCGCGATTTTGCGRTGCG ACCTCGATGCTCGATGACGTAGACTGCGGGTCCATGCCGTGATTTTGCGATGCG 3 (Sequence1,(Sequence2,Sequence3),(Sequence4,Sequence5)); (Sequence2,(Sequence1,Sequence3),(Sequence4,Sequence5)); (Sequence3,(Sequence1,Sequence2),(Sequence4,Sequence5)); Data with transition/transversion ratio and base frequencies to simulate Jukes & Cantor model: 5 114 T T 0.501 0.25 0.25 0.25 0.25 Sequence1 ACACGGTGTCGTATCATGCTGCAGGATGCTAGACTGCGTCANATGTTCGTACTAACTGTG Sequence2 ACGCGGTGTCGTGTCATGCTACATTATGCTAGACTGCGTCGGATGCTCGTATTGACTGCG Sequence3 ACGCGGTGCCGTGTNATGCTGCATTATGCTCGACTGCGRCGGATGCTAGTATTGACTGCG Sequence4 ACGCGCTGCCGTGTCATCCTACACGATGCYAGACAGCGTCAGCTGCTAGTACTGGCTGAG Sequence5 ACGCGCTGTCGTGTCATACTGCAGGATGCTAGACTGCGTCAGCTGCTAGTACTGGCTGAG AGCTCGATGATCGGTGACGTAGACTCAGGGGCCATGCCGCGAGTTTGCGATGCG AGCACGGTGATCAATGACGTAGNCTCAGGRTCCACGCCGTGACTTTGTGATNCG AGCACGATGACCGATGACGTAGACTGAGGGTCCGTGCCGCGACTTTGTGATGCG ACCTCGGTGATTGATGACGTAGACTGCGGGTCCATGCCGCGATTTTGCGRTGCG ACCTCGATGCTCGATGACGTAGACTGCGGGTCCATGCCGTGATTTTGCGATGCG Non-interleaved data: 5 114 F I Sequence1 ACACGGTGTCGTATCATGCTGCAGGATGCTAGACTGCGTCANATGTTCGTACTAACTGTG AGCTCGATGATCGGTGACGTAGACTCAGGGGCCATGCCGCGAGTTTGCGATGCG Sequence2 ACGCGGTGTCGTGTCATGCTACATTATGCTAGACTGCGTCGGATGCTCGTATTGACTGCG AGCACGGTGATCAATGACGTAGNCTCAGGRTCCACGCCGTGACTTTGTGATNCG Sequence3 ACGCGGTGCCGTGTNATGCTGCATTATGCTCGACTGCGRCGGATGCTAGTATTGACTGCG AGCACGATGACCGATGACGTAGACTGAGGGTCCGTGCCGCGACTTTGTGATGCG Sequence4 ACGCGCTGCCGTGTCATCCTACACGATGCYAGACAGCGTCAGCTGCTAGTACTGGCTGAG ACCTCGGTGATTGATGACGTAGACTGCGGGTCCATGCCGCGATTTTGCGRTGCG Sequence5 ACGCGCTGTCGTGTCATACTGCAGGATGCTAGACTGCGTCAGCTGCTAGTACTGGCTGAG ACCTCGATGCTCGATGACGTAGACTGCGGGTCCATGCCGTGATTTTGCGATGCG Non-interleaved data by editing a GenBank format (make sure that the names are padded to at least ten characters with blanks): 5 114 F I Sequence1 1 ACACGGTGTC GTATCATGCT GCAGGATGCT AGACTGCGTC ANATGTTCGT ACTAACTGTG 61 AGCTCGATGA TCGGTGACGT AGACTCAGGG GCCATGCCGC GAGTTTGCGA TGCG Sequence2 1 ACGCGGTGTC GTGTCATGCT ACATTATGCT AGACTGCGTC GGATGCTCGT ATTGACTGCG 61 AGCACGGTGA TCAATGACGT AGNCTCAGGR TCCACGCCGT GACTTTGTGA TNCG Sequence3 1 ACGCGGTGCC GTGTNATGCT GCATTATGCT CGACTGCGRC GGATGCTAGT ATTGACTGCG 61 AGCACGATGA CCGATGACGT AGACTGAGGG TCCGTGCCGC GACTTTGTGA TGCG Sequence4 1 ACGCGCTGCC GTGTCATCCT ACACGATGCY AGACAGCGTC AGCTGCTAGT ACTGGCTGAG 61 ACCTCGGTGA TTGATGACGT AGACTGCGGG TCCATGCCGC GATTTTGCGR TGCG Sequence5 1 ACGCGCTGTC GTGTCATACT GCAGGATGCT AGACTGCGTC AGCTGCTAGT ACTGGCTGAG 61 ACCTCGATGC TCGATGACGT AGACTGCGGG TCCATGCCGT GATTTTGCGA TGCG Data analysis restarted from a four-taxon tree (which happens to be wrong, but it will be corrected by local rearrangements after the tree is read): 5 114 F R Sequence1 ACACGGTGTCGTATCATGCTGCAGGATGCTAGACTGCGTCANATGTTCGTACTAACTGTG Sequence2 ACGCGGTGTCGTGTCATGCTACATTATGCTAGACTGCGTCGGATGCTCGTATTGACTGCG Sequence3 ACGCGGTGCCGTGTNATGCTGCATTATGCTCGACTGCGRCGGATGCTAGTATTGACTGCG Sequence4 ACGCGCTGCCGTGTCATCCTACACGATGCYAGACAGCGTCAGCTGCTAGTACTGGCTGAG Sequence5 ACGCGCTGTCGTGTCATACTGCAGGATGCTAGACTGCGTCAGCTGCTAGTACTGGCTGAG AGCTCGATGATCGGTGACGTAGACTCAGGGGCCATGCCGCGAGTTTGCGATGCG AGCACGGTGATCAATGACGTAGNCTCAGGRTCCACGCCGTGACTTTGTGATNCG AGCACGATGACCGATGACGTAGACTGAGGGTCCGTGCCGCGACTTTGTGATGCG ACCTCGGTGATTGATGACGTAGACTGCGGGTCCATGCCGCGATTTTGCGRTGCG ACCTCGATGCTCGATGACGTAGACTGCGGGTCCATGCCGTGATTTTGCGATGCG (Sequence4:0.1,Sequence2:0.1,(Sequence1:0.1,Sequence5:0.1):0.1):0.0; Data analysis restarted from a four-taxon tree (which is wrong, and which will not be corrected after the tree is read due to the suppression of all rearrangements by the global 0 0 option): 5 114 F R G T G 0 0 T 2.0 Sequence1 ACACGGTGTCGTATCATGCTGCAGGATGCTAGACTGCGTCANATGTTCGTACTAACTGTG Sequence2 ACGCGGTGTCGTGTCATGCTACATTATGCTAGACTGCGTCGGATGCTCGTATTGACTGCG Sequence3 ACGCGGTGCCGTGTNATGCTGCATTATGCTCGACTGCGRCGGATGCTAGTATTGACTGCG Sequence4 ACGCGCTGCCGTGTCATCCTACACGATGCYAGACAGCGTCAGCTGCTAGTACTGGCTGAG Sequence5 ACGCGCTGTCGTGTCATACTGCAGGATGCTAGACTGCGTCAGCTGCTAGTACTGGCTGAG AGCTCGATGATCGGTGACGTAGACTCAGGGGCCATGCCGCGAGTTTGCGATGCG AGCACGGTGATCAATGACGTAGNCTCAGGRTCCACGCCGTGACTTTGTGATNCG AGCACGATGACCGATGACGTAGACTGAGGGTCCGTGCCGCGACTTTGTGATGCG ACCTCGGTGATTGATGACGTAGACTGCGGGTCCATGCCGCGATTTTGCGRTGCG ACCTCGATGCTCGATGACGTAGACTGCGGGTCCATGCCGTGATTTTGCGATGCG (Sequence4:0.1,Sequence2:0.1,(Sequence1:0.1,Sequence5:0.1):0.1):0.0;