Translation

ID #2414

So if I have a template strand of 5' - CTCGATCGGTCAACGTGCCAT - 3', the coding strand will be 3' - GAGCUAGCCAGUUGCACGGUA - 5', but I should read it backwards as 5' - AUGGCACGUUGACCGAUCGAG - 3', therefore the polypeptide sequence would be Met-ala-arg-stop-pro-ile-glu? Or does it just stop at Met-ala-arg because once you hit a stop codon you're done translating?


Just a couple clarifications on what you've written. 
First, you are correct that the peptide would stop after the stop codon. The stop codon causes the combination of the ribosome, mRNA, and peptide chain to dissociate. 
Second, the coding strand is DNA, but you have listed an RNA sequence. The coding strand would be: 3' - GAGCTAGCCAGTTGCACGGTA - 5' 
The sequence you listed (3' - GAGCUAGCCAGUUGCACGGUA - 5') would be the mRNA transcribed from that template. The mRNA is read 5' to 3', so yes, the translation would be based on the sequence 5' - AUGGCACGUUGACCGAUCGAG - 3'. 

Print this record Print this record
Send to a friend Send to a friend
Show this as PDF file Show this as PDF file
Export as XML-File Export as XML-File