DNA->Protein Review Questions

One of your classmates asked about these review questions on page 368-9 of Lewis' Text. To make further comment use this link to go to "Text 'Review' and 'To Think About' Questions" in the Biology Chat Section of Web Crossing.

Question #1 asks about the process of protein synthesis, specifically translation of DNA to messenger RNA (mRNA) and the translation of the message in the mRNA into a specific sequence of amino acids.

Refer to the text, especially figures 16.5 & 16.9 for transcription (DNA-->RNA) and figures 16.10 and 16.11 for translation (mRNA-->Protein).

Here is the link to the whole process on the web that gives an overview of all that is going on. Protein Synthesis

Part a. asks you to label the DNA and mRNA and then figure out where the ribosome would be attached to the mRNA. It is sort of all scrunched up to fit in the drawing. The part with the ribosomes actually occurs in the cytoplasm of eukaryotic cells (like in animals, plants, and fungi). They are attempting to show two sites of translation where the ribosomes would be attached to to the mRNA.

Parts b & C. Here you are right, the drawing gets a little messy because of the twist in the DNA and I think a little artist's error as well. Let's see if I can interpret the nucleotide sequence. I should be able to do it as complementary base pairs:

DNARNA
AU
TA
CG
GC

Unfortunately, here is where the artist got things messed up and it gets really confusing. SO - we need to do a little "intelligent" guessing. Judging by the shapes and colors of the mRNA nucleotides I think the next codons for peptide (protein) b should be:

CUC ACU GAG GAG AGG

To figure out what the next amino acids should be use the "Genetic Code" chart of codons in figure 16.2 or jump to The Universal Genetic Code.

Part e. Look for one of the three stop codons included in the chart among the codons I listed above. Is there one?

Question 2. Parts a, b, and c are sort of like question 1. They give you the sequence of the side of the DNA that is transcribed as:

GCAAAACCGTTATCATGCTTC

Part a asks for the nucleotide sequence of the other strand of DNA.

Here is a hint - the first three letters should be CGT. Can you figure out the rest?

Part b asks for the the mRNA nucleotide sequence. The first three letters should be CGU. Can you figure out the rest?

Part c asks for the amino acid sequence. Work from the mRNA codons and use the Genetic Code Chart in the text (fig 16.2) or The Universal Genetic Code.

Part e asks about a mutation in the DNA. How will it affect the sequence of nucleotides in the mRNA codons and how will that in turn affect the sequence of amino acids?